Review



addgene 535  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc addgene 535
    Addgene 535, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/B%2E+subtilis+Strain+Collection+(Kit+%231000000115%2C+1000000116)/pm41298497-300-34-34
    Average 93 stars, based on 4 article reviews
    addgene 535 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    other:

    Article Title: STRAIGHT-IN enables high-throughput targeting of large DNA payloads in human pluripotent stem cells
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER StemMACSTM Cre Recombinase mRNA Miltenyi Biotec Cat#130-101-113 FIX and PERMTM Cell Permeabilization Kit ThermoFisher Cat#GAS003 E-4031 dihydrochloride Tocris Cat#1808 Verapamil hydrochloride Tocris Cat#0654 Isoprenaline hydrochloride Sigma–Aldrich Cat#I5627 all-trans retinal Sigma–Aldrich Cat#R2500 RNAse A Invitrogen Cat#8003088 Critical commercial assays CloneSmart HCKan Blunt Cloning Kit Sigma–Aldrich Cat#LUC407042 Plasmid-SafeTM ATP-Dependent DNase Biosearch Technologies Cat#E3101K NEBuilder HiFi DNA Assembly Cloning kit New England Biolabs Cat#E5520S NEB PCR Cloning Kit New England Biolabs Cat#E1202S ddPCR Supermix for Probes (no dUTP) Bio-Rad Cat#1863024 QuickExtractTM Biosearch Technologies Cat#QE905T High Pure PCR Template Preparation Kit Roche Cat#11796828001 EnGen sgRNA Synthesis Kit New England Biolabs Cat#E3322V PCR product using theWizard SV Gel and PCR Clean-Up System kit Promega Cat#A9281 NucleoBond Xtra Midi Kit Macherey Nagel Cat#740410.50 NucleoSpin RNA Macherey Nagel Cat#740984.50 DNA-freeTM Kit DNase Treatment and Removal Reagents ThermoFisher Cat#AM1906 iScriptTM cDNA Synthesis Kit Bio-rad Cat#1708891 Deposited data DNA sequencing data This paper https://www.ebi.ac.uk/biostudies/ arrayexpress/studies/E-MTAB-11971 Experimental models: Cell lines LUMC0020iCTRL-06 hiPSC line LUMC hiPSC core facility RRID: CVCL_ZA25 AAVS1_Bxb1 hiPSC line This paper LUMC0020iAAVS-01 AAVS1_4C31 hiPSC line This paper LUMC0020iAAVS-02 AAVS1_Dual hiPSC line This paper LUMC0020iAAVS-03 AAVS1_ASAP2f hiPSC line This paper LUMC0020iAAVS-04 AAVS1_jRCaMP1b hiPSC line This paper LUMC0020iAAVS-05 AAVS1_miRFP703 hiPSC line This paper LUMC0020iAAVS-06 AAVS1_AJMA hiPSC line This paper LUMC0020iAAVS-07 KCNH2+/Acc hiPSC line This paper LUMC0020iHERG-17 KCNH2+/WT hiPSC line clone D1 KCNH2+/WT hiPSC line clone D6 KCNH2+/WT hiPSC line clone G9 This paper LUMC0020iHERG-18 LUMC0020iHERG-19 LUMC0020iHERG-20 KCNH2+/A561T hiPSC line clone D6 KCNH2+/A561T hiPSC line clone E12 KCNH2+/A561T hiPSC line clone F2 This paper LUMC0020iHERG-21 LUMC0020iHERG-22 LUMC0020iHERG-23 Oligonucleotides See Tables S2–S4 Integrated DNA Technologies N/A Recombinant DNA MoClo Toolkit (Weber et al., 2011) Addgene Kit#1000000044 pAGM4673 (Weber et al., 2011) Addgene Plasmid#48014 AAVS1_SA_2A_Neo_CAG_RTTA3 (Sim et al., 2014) Addgene Plasmid#60431 pCAG-NLS-HA-Bxb1 (Hermann et al., 2014) Addgene Plasmid#51271 pCAG-4C31 (Ohtsuka et al., 2015) Addgene Plasmid#62658 (Continued on next page) Cell Reports Methods 2, 100300, October 24, 2022 e2 Article ll OPEN ACCESS

    Article Title: G z ESTY as an optimized cell-based assay for initial steps in GPCR deorphanization
    Article Snippet: Codon-optimized coding sequences of the following receptors were a kind gift from Dr. Bryan Roth (University of North Carolina, NC; Addgene kit no. 1000000068) and were used for subcloning into pcDNA3.1 plasmids removing V2-tail, TEV site, and tTA sequences: follicle-stimulating hormone receptor (FSHR), cannabinoid receptor 1 (CB1R), cannabinoid receptor 2 (CB2R), sphingosine-1 phosphate receptor 1 (S1PR1), lysophosphatidic acid 2 receptor (LPAR2), somatostatin receptor 1 (SSTR1), neuropeptide FF receptor 1 (NPFFR1), free fatty acid receptor 3 (FFA3R), galanin 1 receptor (GALR1), formyl peptide receptor 1 (FPR1), hydroxycarboxylic acid receptor 2 (HCAR2), neuropeptide Y receptor Y1 (NPYR1), protease-activated receptor 1 (PAR1), protease-activated receptor 2 (PAR2), histamine receptor H3 (HRH3), dopamine D1 receptor (D1R), dopamine D3 receptor (D3R), adenosine A2B receptor (ADORA2B), parathyroid hormone 1 receptor (PTH1R), melanocortin 4 receptor (MC4R), calcitonin-like receptor (CLR), serotonin receptor 2A receptor (5-HT2AR), GPR55, and muscarinic receptor 3 (M3R).

    Article Title: STRAIGHT-IN enables high-throughput targeting of large DNA payloads in human pluripotent stem cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER StemMACSTM Cre Recombinase mRNA Miltenyi Biotec Cat#130-101-113 FIX and PERMTM Cell Permeabilization Kit ThermoFisher Cat#GAS003 E-4031 dihydrochloride Tocris Cat#1808 Verapamil hydrochloride Tocris Cat#0654 Isoprenaline hydrochloride Sigma–Aldrich Cat#I5627 all-trans retinal Sigma–Aldrich Cat#R2500 RNAse A Invitrogen Cat#8003088 Critical commercial assays CloneSmart HCKan Blunt Cloning Kit Sigma–Aldrich Cat#LUC407042 Plasmid-SafeTM ATP-Dependent DNase Biosearch Technologies Cat#E3101K NEBuilder HiFi DNA Assembly Cloning kit New England Biolabs Cat#E5520S NEB PCR Cloning Kit New England Biolabs Cat#E1202S ddPCR Supermix for Probes (no dUTP) Bio-Rad Cat#1863024 QuickExtractTM Biosearch Technologies Cat#QE905T High Pure PCR Template Preparation Kit Roche Cat#11796828001 EnGen sgRNA Synthesis Kit New England Biolabs Cat#E3322V PCR product using theWizard SV Gel and PCR Clean-Up System kit Promega Cat#A9281 NucleoBond Xtra Midi Kit Macherey Nagel Cat#740410.50 NucleoSpin RNA Macherey Nagel Cat#740984.50 DNA-freeTM Kit DNase Treatment and Removal Reagents ThermoFisher Cat#AM1906 iScriptTM cDNA Synthesis Kit Bio-rad Cat#1708891 Deposited data DNA sequencing data This paper https://www.ebi.ac.uk/biostudies/ arrayexpress/studies/E-MTAB-11971 Experimental models: Cell lines LUMC0020iCTRL-06 hiPSC line LUMC hiPSC core facility RRID: CVCL_ZA25 AAVS1_Bxb1 hiPSC line This paper LUMC0020iAAVS-01 AAVS1_4C31 hiPSC line This paper LUMC0020iAAVS-02 AAVS1_Dual hiPSC line This paper LUMC0020iAAVS-03 AAVS1_ASAP2f hiPSC line This paper LUMC0020iAAVS-04 AAVS1_jRCaMP1b hiPSC line This paper LUMC0020iAAVS-05 AAVS1_miRFP703 hiPSC line This paper LUMC0020iAAVS-06 AAVS1_AJMA hiPSC line This paper LUMC0020iAAVS-07 KCNH2+/Acc hiPSC line This paper LUMC0020iHERG-17 KCNH2+/WT hiPSC line clone D1 KCNH2+/WT hiPSC line clone D6 KCNH2+/WT hiPSC line clone G9 This paper LUMC0020iHERG-18 LUMC0020iHERG-19 LUMC0020iHERG-20 KCNH2+/A561T hiPSC line clone D6 KCNH2+/A561T hiPSC line clone E12 KCNH2+/A561T hiPSC line clone F2 This paper LUMC0020iHERG-21 LUMC0020iHERG-22 LUMC0020iHERG-23 Oligonucleotides See Tables S2–S4 Integrated DNA Technologies N/A Recombinant DNA MoClo Toolkit (Weber et al., 2011) Addgene Kit#1000000044 pAGM4673 (Weber et al., 2011) Addgene Plasmid#48014 AAVS1_SA_2A_Neo_CAG_RTTA3 (Sim et al., 2014) Addgene Plasmid#60431 pCAG-NLS-HA-Bxb1 (Hermann et al., 2014) Addgene Plasmid#51271 pCAG-4C31 (Ohtsuka et al., 2015) Addgene Plasmid#62658 (Continued on next page) Cell Reports Methods 2, 100300, October 24, 2022 e2

    Cloning:

    Article Title: Reproducibly oriented cell divisions pattern the prothallus to set up dorsoventrality and de novo meristem formation in Marchantia polymorpha
    Article Snippet: .. Escherichia coli : GreenGate Cloning System , Lampropoulos et al. , Addgene Kit #1000000036. ..

    Plasmid Preparation:

    Article Title: Inhibitors supercharge kinase turnover through native proteolytic circuits.
    Article Snippet: The pLEX305-ccdB-Nluc-3×Flag luminescent reporter vector was generated as a destination vector starting from pLEX_305-ccdB-dTAG destination vector (Addgene, 91798) by restriction digest with AgeI and MluI and T4 DNA ligation (NEB) of a synthesized gene block (TWIST) containing the Nluc sequence and a C-terminal 3×Flag tag (5′-CGG GCAAAACCGGTGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGA CAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTG TGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAA AGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTC ATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGA AAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGG TGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAAC ATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGA CGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCC GAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGC ATTCTGGCGGACTACAAGGACCACGACGGTGACTACAAGGACCACG ACATCGACTACAAGGACGACGACGACAAGTAGTAAACGCGTTGACGA TGG-3′). .. To generate a destabilized version of the vector, an identical gene block was synthesized with the addition of the PEST sequence (Promega) 5′-AATTCTCACGGCTTTCCGCCTGAGGTTGAAGAGCAAGC CGCCGGTACATTGCCTATGTCCTGCGCACAAGAAAGCGGTATGGACC GGCACCCAGCCGCTTGTGCTTCAGCTCGATCAACGTC-3′ upstream of the stop codon. pENTR223 Gateway entry vectors for the kinases were obtained from Hahn/Root Labs Human Kinases ORF Kit59,60 (Addgene Kit, 1000000014) with the exception of FYN and MAPK4, which were purchased separately (BCCM, LMBP ORF81088-E05, LMBP ORF81100-B12). pRK5-HA-ubiquitin, pRK5-HA-ubiquitin_K48R and pRK5-HA-ubiquitin_K63R plasmids were provided by G. Versteeg. .. A pENTR221-GFP vector was generated by BP Gateway cloning (Invitrogen), starting from the PCR-amplified GFP sequence of pCAG-GFP61 (gifted by C. Cepko, Addgene, 11150) and insertion into the empty pDONR221 (Invitrogen, 12536017).

    Article Title: The Number of Larval Molts Is Controlled by Hox in Caterpillars.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488-conjugated GFP polyclonal antibody Thermo Fisher Cat#A-21311; RRID: AB_221477 Normal goat serum Sigma-Aldrich Cat#G9023 Biological Samples A genomic DNA panel of B. mori, see Table S1 for details NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) N/A Chemicals, Peptides, and Recombinant Proteins TRIzol Reagent Thermo Fisher Cat#15596018 RNeasy Plus Mini Kit QIAGEN Cat#74134 ReverTra Ace qPCR RT Master Mix with gDNA Remover TOYOBO Cat#FSQ-301 Thunderbird SYBR qPCR Mix TOYOBO Cat#QPS-201 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Thermo Fisher Cat#AM1345 TaKaRa Ex Taq TaKaRa Cat#RR001A Methanol Wako Cat#131-01826 alpha-Ecdysone Cayman Chemical Cat#11711 Rhodamine Phalloidin Thermo Fisher Cat#R415 Critical Commercial Assays 20-Hydroxyecdysone EIA Kit Bertin Bioreagent Cat#A05120 Experimental Models: Organisms/Strains B. mori strain p50 (+M) NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) p50, a nearly isogenic strain used for whole genome sequencing35 B. mori strain pnd w-1 (+M) Tamura et al.36 N/A, a standard strain for transgenesis B. mori strain Kinshu x Showa (+M) Ueda Sanshu N/A, a commercial hybrid strain used for sericulture B. mori strain Shisen-sanmin (M3) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10282 B. mori strain Kyudai-gomin (M5) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10289 D. melanogaster y w, P[y[+].nos-int.NLS]; P [CaryP]attP2 Gift from Diogo Manoel37 N/A D. melanogaster y w; UAS-mCD8::GFP Bloomington Drosophila Stock Center #5137, RRID:BDSC_5137 Oligonucleotides See Table S2 for primers used in this study N/A Recombinant DNA Golden Gate TALEN and TAL effector kit 2.0 Cermak et al.38 Addgene Kit #10000000024 Yamamoto Lab Golden Gate TALEN Accessory Pack Sakuma et al.39 Addgene Kit #10000000030 pBlue-TAL Takasu et al.40 Addgene Plasmid #49401 pBPGAL4.2::VP16Uw Pfeiffer et al.41 Addgene Plasmid #26228 Software and Algorithms ImageJ ImageJ- NIH https://imagej.nih.gov/ij/ FIJI Schindelin et al.42 https://imagej.net/Fiji Adobe Photoshop Adobe RRID:SCR_014199 GraphPad Prism (v.6.0h) GraphPad RRID:SCR_002798 (Continued on next page) e1 Current Biology 31, 884–891.e1–e3, February 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER R (v.3.6.3) R Core Team http://www.r-project.org/index.html Microsoft Excel Microsoft https://www.microsoft.com/en-us/ Leica Application Suite X (LASX) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leica-las-x-ls/ Other Stereomicroscope Leica Microsystems M165FC Digital microscope camera Leica Microsystems DFC7000 T Confocal microscope Zeiss LSM900 Centrifugal evaporator EYELA CVE-2000 Microplate reader Bio-Rad iMark Digital micrometer caliper Mitsutoyo Cat#CD67-S15PS Thermal Cycler Dice Real Time System TaKaRa TP850 LightCycler 480 Real-time PCR System Roche LightCycler 480

    Blocking Assay:

    Article Title: Inhibitors supercharge kinase turnover through native proteolytic circuits.
    Article Snippet: The pLEX305-ccdB-Nluc-3×Flag luminescent reporter vector was generated as a destination vector starting from pLEX_305-ccdB-dTAG destination vector (Addgene, 91798) by restriction digest with AgeI and MluI and T4 DNA ligation (NEB) of a synthesized gene block (TWIST) containing the Nluc sequence and a C-terminal 3×Flag tag (5′-CGG GCAAAACCGGTGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGA CAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTG TGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAA AGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTC ATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGA AAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGG TGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAAC ATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGA CGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCC GAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGC ATTCTGGCGGACTACAAGGACCACGACGGTGACTACAAGGACCACG ACATCGACTACAAGGACGACGACGACAAGTAGTAAACGCGTTGACGA TGG-3′). .. To generate a destabilized version of the vector, an identical gene block was synthesized with the addition of the PEST sequence (Promega) 5′-AATTCTCACGGCTTTCCGCCTGAGGTTGAAGAGCAAGC CGCCGGTACATTGCCTATGTCCTGCGCACAAGAAAGCGGTATGGACC GGCACCCAGCCGCTTGTGCTTCAGCTCGATCAACGTC-3′ upstream of the stop codon. pENTR223 Gateway entry vectors for the kinases were obtained from Hahn/Root Labs Human Kinases ORF Kit59,60 (Addgene Kit, 1000000014) with the exception of FYN and MAPK4, which were purchased separately (BCCM, LMBP ORF81088-E05, LMBP ORF81100-B12). pRK5-HA-ubiquitin, pRK5-HA-ubiquitin_K48R and pRK5-HA-ubiquitin_K63R plasmids were provided by G. Versteeg. .. A pENTR221-GFP vector was generated by BP Gateway cloning (Invitrogen), starting from the PCR-amplified GFP sequence of pCAG-GFP61 (gifted by C. Cepko, Addgene, 11150) and insertion into the empty pDONR221 (Invitrogen, 12536017).

    Synthesized:

    Article Title: Inhibitors supercharge kinase turnover through native proteolytic circuits.
    Article Snippet: The pLEX305-ccdB-Nluc-3×Flag luminescent reporter vector was generated as a destination vector starting from pLEX_305-ccdB-dTAG destination vector (Addgene, 91798) by restriction digest with AgeI and MluI and T4 DNA ligation (NEB) of a synthesized gene block (TWIST) containing the Nluc sequence and a C-terminal 3×Flag tag (5′-CGG GCAAAACCGGTGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGA CAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTG TGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAA AGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTC ATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGA AAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGG TGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAAC ATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGA CGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCC GAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGC ATTCTGGCGGACTACAAGGACCACGACGGTGACTACAAGGACCACG ACATCGACTACAAGGACGACGACGACAAGTAGTAAACGCGTTGACGA TGG-3′). .. To generate a destabilized version of the vector, an identical gene block was synthesized with the addition of the PEST sequence (Promega) 5′-AATTCTCACGGCTTTCCGCCTGAGGTTGAAGAGCAAGC CGCCGGTACATTGCCTATGTCCTGCGCACAAGAAAGCGGTATGGACC GGCACCCAGCCGCTTGTGCTTCAGCTCGATCAACGTC-3′ upstream of the stop codon. pENTR223 Gateway entry vectors for the kinases were obtained from Hahn/Root Labs Human Kinases ORF Kit59,60 (Addgene Kit, 1000000014) with the exception of FYN and MAPK4, which were purchased separately (BCCM, LMBP ORF81088-E05, LMBP ORF81100-B12). pRK5-HA-ubiquitin, pRK5-HA-ubiquitin_K48R and pRK5-HA-ubiquitin_K63R plasmids were provided by G. Versteeg. .. A pENTR221-GFP vector was generated by BP Gateway cloning (Invitrogen), starting from the PCR-amplified GFP sequence of pCAG-GFP61 (gifted by C. Cepko, Addgene, 11150) and insertion into the empty pDONR221 (Invitrogen, 12536017).

    Sequencing:

    Article Title: Inhibitors supercharge kinase turnover through native proteolytic circuits.
    Article Snippet: The pLEX305-ccdB-Nluc-3×Flag luminescent reporter vector was generated as a destination vector starting from pLEX_305-ccdB-dTAG destination vector (Addgene, 91798) by restriction digest with AgeI and MluI and T4 DNA ligation (NEB) of a synthesized gene block (TWIST) containing the Nluc sequence and a C-terminal 3×Flag tag (5′-CGG GCAAAACCGGTGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGA CAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTG TGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAA AGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTC ATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGA AAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGG TGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAAC ATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGA CGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAA ATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCC GAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGC ATTCTGGCGGACTACAAGGACCACGACGGTGACTACAAGGACCACG ACATCGACTACAAGGACGACGACGACAAGTAGTAAACGCGTTGACGA TGG-3′). .. To generate a destabilized version of the vector, an identical gene block was synthesized with the addition of the PEST sequence (Promega) 5′-AATTCTCACGGCTTTCCGCCTGAGGTTGAAGAGCAAGC CGCCGGTACATTGCCTATGTCCTGCGCACAAGAAAGCGGTATGGACC GGCACCCAGCCGCTTGTGCTTCAGCTCGATCAACGTC-3′ upstream of the stop codon. pENTR223 Gateway entry vectors for the kinases were obtained from Hahn/Root Labs Human Kinases ORF Kit59,60 (Addgene Kit, 1000000014) with the exception of FYN and MAPK4, which were purchased separately (BCCM, LMBP ORF81088-E05, LMBP ORF81100-B12). pRK5-HA-ubiquitin, pRK5-HA-ubiquitin_K48R and pRK5-HA-ubiquitin_K63R plasmids were provided by G. Versteeg. .. A pENTR221-GFP vector was generated by BP Gateway cloning (Invitrogen), starting from the PCR-amplified GFP sequence of pCAG-GFP61 (gifted by C. Cepko, Addgene, 11150) and insertion into the empty pDONR221 (Invitrogen, 12536017).

    Recombinant:

    Article Title: The Number of Larval Molts Is Controlled by Hox in Caterpillars.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488-conjugated GFP polyclonal antibody Thermo Fisher Cat#A-21311; RRID: AB_221477 Normal goat serum Sigma-Aldrich Cat#G9023 Biological Samples A genomic DNA panel of B. mori, see Table S1 for details NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) N/A Chemicals, Peptides, and Recombinant Proteins TRIzol Reagent Thermo Fisher Cat#15596018 RNeasy Plus Mini Kit QIAGEN Cat#74134 ReverTra Ace qPCR RT Master Mix with gDNA Remover TOYOBO Cat#FSQ-301 Thunderbird SYBR qPCR Mix TOYOBO Cat#QPS-201 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Thermo Fisher Cat#AM1345 TaKaRa Ex Taq TaKaRa Cat#RR001A Methanol Wako Cat#131-01826 alpha-Ecdysone Cayman Chemical Cat#11711 Rhodamine Phalloidin Thermo Fisher Cat#R415 Critical Commercial Assays 20-Hydroxyecdysone EIA Kit Bertin Bioreagent Cat#A05120 Experimental Models: Organisms/Strains B. mori strain p50 (+M) NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) p50, a nearly isogenic strain used for whole genome sequencing35 B. mori strain pnd w-1 (+M) Tamura et al.36 N/A, a standard strain for transgenesis B. mori strain Kinshu x Showa (+M) Ueda Sanshu N/A, a commercial hybrid strain used for sericulture B. mori strain Shisen-sanmin (M3) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10282 B. mori strain Kyudai-gomin (M5) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10289 D. melanogaster y w, P[y[+].nos-int.NLS]; P [CaryP]attP2 Gift from Diogo Manoel37 N/A D. melanogaster y w; UAS-mCD8::GFP Bloomington Drosophila Stock Center #5137, RRID:BDSC_5137 Oligonucleotides See Table S2 for primers used in this study N/A Recombinant DNA Golden Gate TALEN and TAL effector kit 2.0 Cermak et al.38 Addgene Kit #10000000024 Yamamoto Lab Golden Gate TALEN Accessory Pack Sakuma et al.39 Addgene Kit #10000000030 pBlue-TAL Takasu et al.40 Addgene Plasmid #49401 pBPGAL4.2::VP16Uw Pfeiffer et al.41 Addgene Plasmid #26228 Software and Algorithms ImageJ ImageJ- NIH https://imagej.nih.gov/ij/ FIJI Schindelin et al.42 https://imagej.net/Fiji Adobe Photoshop Adobe RRID:SCR_014199 GraphPad Prism (v.6.0h) GraphPad RRID:SCR_002798 (Continued on next page) e1 Current Biology 31, 884–891.e1–e3, February 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER R (v.3.6.3) R Core Team http://www.r-project.org/index.html Microsoft Excel Microsoft https://www.microsoft.com/en-us/ Leica Application Suite X (LASX) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leica-las-x-ls/ Other Stereomicroscope Leica Microsystems M165FC Digital microscope camera Leica Microsystems DFC7000 T Confocal microscope Zeiss LSM900 Centrifugal evaporator EYELA CVE-2000 Microplate reader Bio-Rad iMark Digital micrometer caliper Mitsutoyo Cat#CD67-S15PS Thermal Cycler Dice Real Time System TaKaRa TP850 LightCycler 480 Real-time PCR System Roche LightCycler 480

    Real-time Polymerase Chain Reaction:

    Article Title: The Number of Larval Molts Is Controlled by Hox in Caterpillars.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488-conjugated GFP polyclonal antibody Thermo Fisher Cat#A-21311; RRID: AB_221477 Normal goat serum Sigma-Aldrich Cat#G9023 Biological Samples A genomic DNA panel of B. mori, see Table S1 for details NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) N/A Chemicals, Peptides, and Recombinant Proteins TRIzol Reagent Thermo Fisher Cat#15596018 RNeasy Plus Mini Kit QIAGEN Cat#74134 ReverTra Ace qPCR RT Master Mix with gDNA Remover TOYOBO Cat#FSQ-301 Thunderbird SYBR qPCR Mix TOYOBO Cat#QPS-201 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Thermo Fisher Cat#AM1345 TaKaRa Ex Taq TaKaRa Cat#RR001A Methanol Wako Cat#131-01826 alpha-Ecdysone Cayman Chemical Cat#11711 Rhodamine Phalloidin Thermo Fisher Cat#R415 Critical Commercial Assays 20-Hydroxyecdysone EIA Kit Bertin Bioreagent Cat#A05120 Experimental Models: Organisms/Strains B. mori strain p50 (+M) NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) p50, a nearly isogenic strain used for whole genome sequencing35 B. mori strain pnd w-1 (+M) Tamura et al.36 N/A, a standard strain for transgenesis B. mori strain Kinshu x Showa (+M) Ueda Sanshu N/A, a commercial hybrid strain used for sericulture B. mori strain Shisen-sanmin (M3) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10282 B. mori strain Kyudai-gomin (M5) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10289 D. melanogaster y w, P[y[+].nos-int.NLS]; P [CaryP]attP2 Gift from Diogo Manoel37 N/A D. melanogaster y w; UAS-mCD8::GFP Bloomington Drosophila Stock Center #5137, RRID:BDSC_5137 Oligonucleotides See Table S2 for primers used in this study N/A Recombinant DNA Golden Gate TALEN and TAL effector kit 2.0 Cermak et al.38 Addgene Kit #10000000024 Yamamoto Lab Golden Gate TALEN Accessory Pack Sakuma et al.39 Addgene Kit #10000000030 pBlue-TAL Takasu et al.40 Addgene Plasmid #49401 pBPGAL4.2::VP16Uw Pfeiffer et al.41 Addgene Plasmid #26228 Software and Algorithms ImageJ ImageJ- NIH https://imagej.nih.gov/ij/ FIJI Schindelin et al.42 https://imagej.net/Fiji Adobe Photoshop Adobe RRID:SCR_014199 GraphPad Prism (v.6.0h) GraphPad RRID:SCR_002798 (Continued on next page) e1 Current Biology 31, 884–891.e1–e3, February 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER R (v.3.6.3) R Core Team http://www.r-project.org/index.html Microsoft Excel Microsoft https://www.microsoft.com/en-us/ Leica Application Suite X (LASX) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leica-las-x-ls/ Other Stereomicroscope Leica Microsystems M165FC Digital microscope camera Leica Microsystems DFC7000 T Confocal microscope Zeiss LSM900 Centrifugal evaporator EYELA CVE-2000 Microplate reader Bio-Rad iMark Digital micrometer caliper Mitsutoyo Cat#CD67-S15PS Thermal Cycler Dice Real Time System TaKaRa TP850 LightCycler 480 Real-time PCR System Roche LightCycler 480

    Enzyme-linked Immunosorbent Assay:

    Article Title: The Number of Larval Molts Is Controlled by Hox in Caterpillars.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488-conjugated GFP polyclonal antibody Thermo Fisher Cat#A-21311; RRID: AB_221477 Normal goat serum Sigma-Aldrich Cat#G9023 Biological Samples A genomic DNA panel of B. mori, see Table S1 for details NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) N/A Chemicals, Peptides, and Recombinant Proteins TRIzol Reagent Thermo Fisher Cat#15596018 RNeasy Plus Mini Kit QIAGEN Cat#74134 ReverTra Ace qPCR RT Master Mix with gDNA Remover TOYOBO Cat#FSQ-301 Thunderbird SYBR qPCR Mix TOYOBO Cat#QPS-201 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Thermo Fisher Cat#AM1345 TaKaRa Ex Taq TaKaRa Cat#RR001A Methanol Wako Cat#131-01826 alpha-Ecdysone Cayman Chemical Cat#11711 Rhodamine Phalloidin Thermo Fisher Cat#R415 Critical Commercial Assays 20-Hydroxyecdysone EIA Kit Bertin Bioreagent Cat#A05120 Experimental Models: Organisms/Strains B. mori strain p50 (+M) NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) p50, a nearly isogenic strain used for whole genome sequencing35 B. mori strain pnd w-1 (+M) Tamura et al.36 N/A, a standard strain for transgenesis B. mori strain Kinshu x Showa (+M) Ueda Sanshu N/A, a commercial hybrid strain used for sericulture B. mori strain Shisen-sanmin (M3) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10282 B. mori strain Kyudai-gomin (M5) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10289 D. melanogaster y w, P[y[+].nos-int.NLS]; P [CaryP]attP2 Gift from Diogo Manoel37 N/A D. melanogaster y w; UAS-mCD8::GFP Bloomington Drosophila Stock Center #5137, RRID:BDSC_5137 Oligonucleotides See Table S2 for primers used in this study N/A Recombinant DNA Golden Gate TALEN and TAL effector kit 2.0 Cermak et al.38 Addgene Kit #10000000024 Yamamoto Lab Golden Gate TALEN Accessory Pack Sakuma et al.39 Addgene Kit #10000000030 pBlue-TAL Takasu et al.40 Addgene Plasmid #49401 pBPGAL4.2::VP16Uw Pfeiffer et al.41 Addgene Plasmid #26228 Software and Algorithms ImageJ ImageJ- NIH https://imagej.nih.gov/ij/ FIJI Schindelin et al.42 https://imagej.net/Fiji Adobe Photoshop Adobe RRID:SCR_014199 GraphPad Prism (v.6.0h) GraphPad RRID:SCR_002798 (Continued on next page) e1 Current Biology 31, 884–891.e1–e3, February 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER R (v.3.6.3) R Core Team http://www.r-project.org/index.html Microsoft Excel Microsoft https://www.microsoft.com/en-us/ Leica Application Suite X (LASX) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leica-las-x-ls/ Other Stereomicroscope Leica Microsystems M165FC Digital microscope camera Leica Microsystems DFC7000 T Confocal microscope Zeiss LSM900 Centrifugal evaporator EYELA CVE-2000 Microplate reader Bio-Rad iMark Digital micrometer caliper Mitsutoyo Cat#CD67-S15PS Thermal Cycler Dice Real Time System TaKaRa TP850 LightCycler 480 Real-time PCR System Roche LightCycler 480

    Software:

    Article Title: The Number of Larval Molts Is Controlled by Hox in Caterpillars.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488-conjugated GFP polyclonal antibody Thermo Fisher Cat#A-21311; RRID: AB_221477 Normal goat serum Sigma-Aldrich Cat#G9023 Biological Samples A genomic DNA panel of B. mori, see Table S1 for details NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) N/A Chemicals, Peptides, and Recombinant Proteins TRIzol Reagent Thermo Fisher Cat#15596018 RNeasy Plus Mini Kit QIAGEN Cat#74134 ReverTra Ace qPCR RT Master Mix with gDNA Remover TOYOBO Cat#FSQ-301 Thunderbird SYBR qPCR Mix TOYOBO Cat#QPS-201 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Thermo Fisher Cat#AM1345 TaKaRa Ex Taq TaKaRa Cat#RR001A Methanol Wako Cat#131-01826 alpha-Ecdysone Cayman Chemical Cat#11711 Rhodamine Phalloidin Thermo Fisher Cat#R415 Critical Commercial Assays 20-Hydroxyecdysone EIA Kit Bertin Bioreagent Cat#A05120 Experimental Models: Organisms/Strains B. mori strain p50 (+M) NBRP Silkworm (https://silkworm.nbrp.jp/ index_en.html) p50, a nearly isogenic strain used for whole genome sequencing35 B. mori strain pnd w-1 (+M) Tamura et al.36 N/A, a standard strain for transgenesis B. mori strain Kinshu x Showa (+M) Ueda Sanshu N/A, a commercial hybrid strain used for sericulture B. mori strain Shisen-sanmin (M3) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10282 B. mori strain Kyudai-gomin (M5) NARO Genebank (https://www.gene.affrc. go.jp/index_en.php) ANJP10289 D. melanogaster y w, P[y[+].nos-int.NLS]; P [CaryP]attP2 Gift from Diogo Manoel37 N/A D. melanogaster y w; UAS-mCD8::GFP Bloomington Drosophila Stock Center #5137, RRID:BDSC_5137 Oligonucleotides See Table S2 for primers used in this study N/A Recombinant DNA Golden Gate TALEN and TAL effector kit 2.0 Cermak et al.38 Addgene Kit #10000000024 Yamamoto Lab Golden Gate TALEN Accessory Pack Sakuma et al.39 Addgene Kit #10000000030 pBlue-TAL Takasu et al.40 Addgene Plasmid #49401 pBPGAL4.2::VP16Uw Pfeiffer et al.41 Addgene Plasmid #26228 Software and Algorithms ImageJ ImageJ- NIH https://imagej.nih.gov/ij/ FIJI Schindelin et al.42 https://imagej.net/Fiji Adobe Photoshop Adobe RRID:SCR_014199 GraphPad Prism (v.6.0h) GraphPad RRID:SCR_002798 (Continued on next page) e1 Current Biology 31, 884–891.e1–e3, February 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER R (v.3.6.3) R Core Team http://www.r-project.org/index.html Microsoft Excel Microsoft https://www.microsoft.com/en-us/ Leica Application Suite X (LASX) Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leica-las-x-ls/ Other Stereomicroscope Leica Microsystems M165FC Digital microscope camera Leica Microsystems DFC7000 T Confocal microscope Zeiss LSM900 Centrifugal evaporator EYELA CVE-2000 Microplate reader Bio-Rad iMark Digital micrometer caliper Mitsutoyo Cat#CD67-S15PS Thermal Cycler Dice Real Time System TaKaRa TP850 LightCycler 480 Real-time PCR System Roche LightCycler 480



    Similar Products

    93
    Addgene inc addgene 535
    Addgene 535, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/B%2E+subtilis+Strain+Collection+(Kit+%231000000115%2C+1000000116)/pm41298497-300-34-34
    Average 93 stars, based on 1 article reviews
    addgene 535 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc addgene kit
    Addgene Kit, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/Hahn%2FRoot+Labs+-+Human+Kinase+ORF+Kit+(Kit+%231000000014)/pm41299171-575-46-46
    Average 93 stars, based on 1 article reviews
    addgene kit - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px330s addgene
    Px330s Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/Multiplex+CRISPR%2FCas9+Assembly+Systems+(Kit+%231000000055%2C+1000000062)/pmc12577684__sciadv%2Eadx7431_sm-135-7-8
    Average 93 stars, based on 1 article reviews
    px330s addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc assays multiplex crispr cas9 assembly kit addgene
    Assays Multiplex Crispr Cas9 Assembly Kit Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/Multiplex+CRISPR%2FCas9+Assembly+Systems+(Kit+%231000000055%2C+1000000062)/pmc12577684__sciadv%2Eadx7431_sm-129-227-232
    Average 93 stars, based on 1 article reviews
    assays multiplex crispr cas9 assembly kit addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc gene knockout kit human ccnc recombinant dna teichmann pmscv u6sgrna bbsi pgkpuro2abfp retroviral sgrna transfer plasmid addgene
    Gene Knockout Kit Human Ccnc Recombinant Dna Teichmann Pmscv U6sgrna Bbsi Pgkpuro2abfp Retroviral Sgrna Transfer Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP+(Plasmid+%23102796)/pm40845844-230-71-86
    Average 93 stars, based on 1 article reviews
    gene knockout kit human ccnc recombinant dna teichmann pmscv u6sgrna bbsi pgkpuro2abfp retroviral sgrna transfer plasmid addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc resource source identifier pcdna5 frt to galphaq rluc8 addgene kit
    Resource Source Identifier Pcdna5 Frt To Galphaq Rluc8 Addgene Kit, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/pcDNA5%2FFRT%2FTO-GAlphaQ-RLuc8+(Plasmid+%23140982)/pm40393456-324-2-6
    Average 93 stars, based on 1 article reviews
    resource source identifier pcdna5 frt to galphaq rluc8 addgene kit - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 1 ggamma9 gfp2 addgene kit
    Pcdna3 1 Ggamma9 Gfp2 Addgene Kit, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/pcDNA3%2E1-GGamma9-GFP2+(Plasmid+%23140991)/pm40393456-324-13-14
    Average 93 stars, based on 1 article reviews
    pcdna3 1 ggamma9 gfp2 addgene kit - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    95
    Addgene inc addgene moclo toolkit
    Addgene Moclo Toolkit, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/MoClo+Toolkit+(Kit+%231000000044)/bio_rxiv__2025__06__02__657020-64-33-33
    Average 95 stars, based on 1 article reviews
    addgene moclo toolkit - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    Addgene inc addgene derived template
    Addgene Derived Template, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+kit/GreenGate+Cloning+System+(Kit+%231000000036)/pm39823275-51-19-19
    Average 93 stars, based on 1 article reviews
    addgene derived template - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results